Perl Programming
 
Forums: » Register « |  User CP |  Games |  Calendar |  Members |  FAQs |  Sitemap |  Support | 
User Name:
Password:
Remember me

The Shed is going Social! Join us on FaceBook and Twitter and chime in on the conversation.

Go Back   Dev Shed ForumsProgramming LanguagesPerl Programming

Reply
Add This Thread To:
  Del.icio.us   Digg   Google   Spurl   Blink   Furl   Simpy   Y! MyWeb 
Thread Tools Search this Thread Rate Thread Display Modes
 
Unread Dev Shed Forums Sponsor:
  #1  
Old August 27th, 2012, 06:48 AM
anandhi anandhi is offline
Registered User
Dev Shed Newbie (0 - 499 posts)
 
Join Date: Aug 2012
Posts: 1 anandhi User rank is Just a Lowly Private (1 - 20 Reputation Level) 
Time spent in forums: 17 m 26 sec
Reputation Power: 0
Converting dna to protein using standard genetic code.

#!/usr/bin/perl
use strict;
my%std_genetic_code=("ATA"=>"ISO", "CTC"=>"LEU", "GTT"=> "VAL","TTT"=>"PHEN");
#PROCESS INPUT DATA
while($line=<DATA>)
{
print "line:$line";
chop();
@triplets = unpack("a4"*(lengthof($line)/3)"$line");
for each $codon(at triplets)
{
print("$std_genetic_code($codon)";
}
print"\n\n";
}
#what follows is input data
_END_
ATTATGCATAATGCCTTCTCGTTGTCGTATTTTTCATGAAATGCATCATACTTCTCGTTCTCAATCGGATATGTTTTTT;
~
~

Reply With Quote
  #2  
Old August 27th, 2012, 12:55 PM
Laurent_R Laurent_R is offline
Contributing User
Dev Shed Novice (500 - 999 posts)
 
Join Date: Jun 2012
Posts: 511 Laurent_R User rank is Lieutenant Colonel (40000 - 50000 Reputation Level)Laurent_R User rank is Lieutenant Colonel (40000 - 50000 Reputation Level)Laurent_R User rank is Lieutenant Colonel (40000 - 50000 Reputation Level)Laurent_R User rank is Lieutenant Colonel (40000 - 50000 Reputation Level)Laurent_R User rank is Lieutenant Colonel (40000 - 50000 Reputation Level)Laurent_R User rank is Lieutenant Colonel (40000 - 50000 Reputation Level)Laurent_R User rank is Lieutenant Colonel (40000 - 50000 Reputation Level)Laurent_R User rank is Lieutenant Colonel (40000 - 50000 Reputation Level)Laurent_R User rank is Lieutenant Colonel (40000 - 50000 Reputation Level)Laurent_R User rank is Lieutenant Colonel (40000 - 50000 Reputation Level)Laurent_R User rank is Lieutenant Colonel (40000 - 50000 Reputation Level) 
Time spent in forums: 4 Days 19 h 57 m 48 sec
Reputation Power: 405
Do you have a question?

Or comments or explanations?

Reply With Quote
  #3  
Old August 27th, 2012, 02:39 PM
FishMonger FishMonger is offline
Contributing User
Dev Shed Intermediate (1500 - 1999 posts)
 
Join Date: Apr 2009
Posts: 1,652 FishMonger User rank is General 3rd Grade (Above 100000 Reputation Level)FishMonger User rank is General 3rd Grade (Above 100000 Reputation Level)FishMonger User rank is General 3rd Grade (Above 100000 Reputation Level)FishMonger User rank is General 3rd Grade (Above 100000 Reputation Level)FishMonger User rank is General 3rd Grade (Above 100000 Reputation Level)FishMonger User rank is General 3rd Grade (Above 100000 Reputation Level)FishMonger User rank is General 3rd Grade (Above 100000 Reputation Level)FishMonger User rank is General 3rd Grade (Above 100000 Reputation Level)FishMonger User rank is General 3rd Grade (Above 100000 Reputation Level)FishMonger User rank is General 3rd Grade (Above 100000 Reputation Level)FishMonger User rank is General 3rd Grade (Above 100000 Reputation Level)FishMonger User rank is General 3rd Grade (Above 100000 Reputation Level)FishMonger User rank is General 3rd Grade (Above 100000 Reputation Level)FishMonger User rank is General 3rd Grade (Above 100000 Reputation Level)FishMonger User rank is General 3rd Grade (Above 100000 Reputation Level)FishMonger User rank is General 3rd Grade (Above 100000 Reputation Level) 
Time spent in forums: 1 Month 2 Weeks 2 Days 5 h 32 m 21 sec
Reputation Power: 1170
Other than telling you the fact that your code doesn't compile, I have no idea what you want from us.

Reply With Quote
  #4  
Old September 8th, 2012, 08:21 PM
Axweildr's Avatar
Axweildr Axweildr is offline
'fie' on me, allege-dly
Click here for more information.
 
Join Date: Mar 2003
Location: in da kitchen ...
Posts: 12,874 Axweildr User rank is General 81st Grade (Above 100000 Reputation Level)Axweildr User rank is General 81st Grade (Above 100000 Reputation Level)Axweildr User rank is General 81st Grade (Above 100000 Reputation Level)Axweildr User rank is General 81st Grade (Above 100000 Reputation Level)Axweildr User rank is General 81st Grade (Above 100000 Reputation Level)Axweildr User rank is General 81st Grade (Above 100000 Reputation Level)Axweildr User rank is General 81st Grade (Above 100000 Reputation Level)Axweildr User rank is General 81st Grade (Above 100000 Reputation Level)Axweildr User rank is General 81st Grade (Above 100000 Reputation Level)Axweildr User rank is General 81st Grade (Above 100000 Reputation Level)Axweildr User rank is General 81st Grade (Above 100000 Reputation Level)Axweildr User rank is General 81st Grade (Above 100000 Reputation Level)Axweildr User rank is General 81st Grade (Above 100000 Reputation Level)Axweildr User rank is General 81st Grade (Above 100000 Reputation Level)Axweildr User rank is General 81st Grade (Above 100000 Reputation Level)Axweildr User rank is General 81st Grade (Above 100000 Reputation Level)  Folding Points: 162285 Folding Title: Super Ultimate Folder - Level 1Folding Points: 162285 Folding Title: Super Ultimate Folder - Level 1Folding Points: 162285 Folding Title: Super Ultimate Folder - Level 1Folding Points: 162285 Folding Title: Super Ultimate Folder - Level 1Folding Points: 162285 Folding Title: Super Ultimate Folder - Level 1Folding Points: 162285 Folding Title: Super Ultimate Folder - Level 1
Time spent in forums: 4 Months 2 Weeks 1 Day 20 h 28 m 56 sec
Reputation Power: 6421
Send a message via Google Talk to Axweildr
Orkut
Could this be the T-Shirt for 'spring break'?
__________________
--Ax
without exception, there is no rule ...
Handmade Irish Jewellery
Targeted Advertising Cookie Optout (TACO) extension for Firefox
The great thing about Object Oriented code is that it can make small, simple problems look like large, complex ones


09 F9 11 02
9D 74 E3 5B
D8 41 56 C5
63 56 88 C0
Some people, when confronted with a problem, think "I know, I'll use regular expressions." Now they have two problems.
-- Jamie Zawinski
Detavil - the devil is in the detail, allegedly, and I use the term advisedly, allegedly ... oh, no, wait I did ...
BIT COINS ANYONE

Reply With Quote
Reply

Viewing: Dev Shed ForumsProgramming LanguagesPerl Programming > Converting dna to protein using standard genetic code.

Developer Shed Advertisers and Affiliates



Thread Tools  Search this Thread 
Search this Thread:

Advanced Search
Display Modes  Rate This Thread 
Rate This Thread:


Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

vB code is On
Smilies are On
[IMG] code is On
HTML code is Off
View Your Warnings | New Posts | Latest News | Latest Threads | Shoutbox
Forum Jump

Forums: » Register « |  User CP |  Games |  Calendar |  Members |  FAQs |  Sitemap |  Support | 
  
 


Powered by: vBulletin Version 3.0.5
Copyright ©2000 - 2013, Jelsoft Enterprises Ltd.

© 2003-2013 by Developer Shed. All rights reserved. DS Cluster - Follow our Sitemap