#1
  1. No Profile Picture
    Registered User
    Devshed Newbie (0 - 499 posts)

    Join Date
    Apr 2013
    Posts
    2
    Rep Power
    0

    Trouble importing fasta format


    I am trying to import 2 DNA sequences which are saved in fasta format in a text file.

    >Testseq1
    TTTGGTGTCCTAGGCGTAGAGGAACCACACCGGTCCATCCCGAACTTGGTGGTTAAACTCTACTGCGGTGAACGATACTGTCC
    >Testseq2
    TGGTGCGGTCATACCAGCGCTAATGCACCGGATCCCATCAGAACTCCGCAGTTAAGCGCGCTTGGGCGAGAACAGTACTGGGATGGGTGTCC

    I need to be able to import the sequences into python and implement them in a sequence alignment algorithm. Any help would be greatly appreciated!
  2. #2
  3. Contributing User
    Devshed Demi-God (4500 - 4999 posts)

    Join Date
    Aug 2011
    Posts
    4,841
    Rep Power
    480
    Please search the internet using google search

    site:forums.devshed.com/python-programming-11 fasta

    Read through the threads and see if your questions are answered.


    https://www.google.com/search?qscrl=1&biw=1066&bih=595&output=search&sclient=psy-ab&q=site%3Aforums.devshed.com%2Fpython-programming-11+fasta&btnK=&qscrl=1
    [code]Code tags[/code] are essential for python code and Makefiles!
  4. #3
  5. Contributing User
    Devshed Demi-God (4500 - 4999 posts)

    Join Date
    Aug 2011
    Posts
    4,841
    Rep Power
    480
    http://rosettacode.org/wiki/FASTA_format#Python
    [code]Code tags[/code] are essential for python code and Makefiles!

IMN logo majestic logo threadwatch logo seochat tools logo